Phishing is a form of cybercrime in which people are deceived into exposing their personal information which can result in ...
OrcaRouter, the OpenAI-compatible LLM gateway, today published The AI Threat Report 2026 and made two of its security controls available at no cost to all users: the agent Firewall and input/output ...
I'll be sitting this one out ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Last Tuesday, Microsoft patched a vulnerability it rated as max critical in its M365 Copilot AI platform. On Monday, the ...
Modern browsers let you share a link that jumps straight to whatever text you wish to highlight. Here’s how the feature works.
Netflix's hidden genre codes bypass the algorithm entirely and drop you straight into whatever category you're actually in ...
GAINESVILLE, Fla. — Students in both classrooms were considering historic events. In Introduction to Sociology, the discussion was about globalization. Three buildings over, a Civil Discourse class ...
Global report provides an alternative to climate breakdown, political extremism and economic tensions ‘Happiness is not just about GDP’: ambitious plan or utopia? Humanity can raise living standards, ...
Experts recommend setting your thermostat to 78 degrees or higher in the summer to save energy. Regularly maintaining your air-conditioning unit and cleaning its filter can improve efficiency and ...